|
Left Crispr |
Right Crispr |
| Crispr ID |
1041823806 |
1041823815 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:62068646-62068668
|
8:62068693-62068715
|
| Sequence |
CCCTGCAAAGTCACAGGGGCAGA |
TCTCTTGCATCAGCATGACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 30, 1: 550, 2: 995, 3: 1542, 4: 1637} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|