ID: 1041823807_1041823810

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1041823807 1041823810
Species Human (GRCh38) Human (GRCh38)
Location 8:62068647-62068669 8:62068664-62068686
Sequence CCTGCAAAGTCACAGGGGCAGAG GCAGAGCTACCCAAGGCCATGGG
Strand - +
Off-target summary {0: 23, 1: 569, 2: 1002, 3: 1597, 4: 1862} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!