ID: 1041853384_1041853386

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1041853384 1041853386
Species Human (GRCh38) Human (GRCh38)
Location 8:62419496-62419518 8:62419521-62419543
Sequence CCAGTAAATGGCCAGATGGTATT CAAGTAATGCTGTCATAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!