ID: 1041897976_1041897979

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1041897976 1041897979
Species Human (GRCh38) Human (GRCh38)
Location 8:62948051-62948073 8:62948085-62948107
Sequence CCGCTTAGAGGTTAAATAATTTG ACAACTAGTAAGTGTAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 43, 4: 401} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!