ID: 1041921466_1041921470

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1041921466 1041921470
Species Human (GRCh38) Human (GRCh38)
Location 8:63186984-63187006 8:63187001-63187023
Sequence CCACCACAACCACAGCAGCAACA GCAACAAGGACCTCAGCCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 108, 4: 994} {0: 1, 1: 0, 2: 2, 3: 9, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!