ID: 1042223308_1042223314

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1042223308 1042223314
Species Human (GRCh38) Human (GRCh38)
Location 8:66494462-66494484 8:66494494-66494516
Sequence CCTCCATGACTCAGGCTTAGCCC TTGTCAGCCTTGAATGAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 175} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!