ID: 1042223309_1042223314

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1042223309 1042223314
Species Human (GRCh38) Human (GRCh38)
Location 8:66494465-66494487 8:66494494-66494516
Sequence CCATGACTCAGGCTTAGCCCCTG TTGTCAGCCTTGAATGAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!