ID: 1042233710_1042233712

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1042233710 1042233712
Species Human (GRCh38) Human (GRCh38)
Location 8:66586380-66586402 8:66586396-66586418
Sequence CCAATATTTCTCAAAAGAAAACA GAAAACATACAAATGGACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 143, 4: 995} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!