ID: 1042238076_1042238083

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1042238076 1042238083
Species Human (GRCh38) Human (GRCh38)
Location 8:66635714-66635736 8:66635750-66635772
Sequence CCAGCCTGGCCAACGTGGTGAAA GAGAATACACAAAATTAGCTGGG
Strand - +
Off-target summary {0: 4389, 1: 97729, 2: 164785, 3: 171879, 4: 157080} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!