ID: 1042238078_1042238083

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1042238078 1042238083
Species Human (GRCh38) Human (GRCh38)
Location 8:66635723-66635745 8:66635750-66635772
Sequence CCAACGTGGTGAAACCCCAACTC GAGAATACACAAAATTAGCTGGG
Strand - +
Off-target summary {0: 16, 1: 2515, 2: 48033, 3: 104603, 4: 134304} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!