ID: 1042277212_1042277215

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1042277212 1042277215
Species Human (GRCh38) Human (GRCh38)
Location 8:67018457-67018479 8:67018473-67018495
Sequence CCCAGGCTGGCGTGTAGTGGCTA GTGGCTATTCACAGGCATGTAGG
Strand - +
Off-target summary {0: 1, 1: 45, 2: 1131, 3: 17591, 4: 192992} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!