ID: 1042323455_1042323463

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1042323455 1042323463
Species Human (GRCh38) Human (GRCh38)
Location 8:67503384-67503406 8:67503410-67503432
Sequence CCTCCTGAGTTCAACAGGTCCTC CCTCAGCCTCTGGAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 708, 4: 11047} {0: 2984, 1: 16415, 2: 226878, 3: 278634, 4: 169895}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!