ID: 1042323455_1042323465

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1042323455 1042323465
Species Human (GRCh38) Human (GRCh38)
Location 8:67503384-67503406 8:67503418-67503440
Sequence CCTCCTGAGTTCAACAGGTCCTC TCTGGAGTAGCTGGGACTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 708, 4: 11047} {0: 1302, 1: 9603, 2: 118577, 3: 247901, 4: 241623}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!