ID: 1042323458_1042323465

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1042323458 1042323465
Species Human (GRCh38) Human (GRCh38)
Location 8:67503403-67503425 8:67503418-67503440
Sequence CCTCCCTCCTCAGCCTCTGGAGT TCTGGAGTAGCTGGGACTACAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!