ID: 1042624994_1042624998

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1042624994 1042624998
Species Human (GRCh38) Human (GRCh38)
Location 8:70748286-70748308 8:70748305-70748327
Sequence CCAGCTGCAGCTCTAGACCTGGG TGGGCATCCCTGCACTCGCAGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 18, 3: 41, 4: 318} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!