ID: 1042629968_1042629976

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1042629968 1042629976
Species Human (GRCh38) Human (GRCh38)
Location 8:70805670-70805692 8:70805715-70805737
Sequence CCTGACTCATCCTTACTGGGTGA TAACTCCAGCCAGAGGCTCCCGG
Strand - +
Off-target summary No data {0: 3, 1: 62, 2: 94, 3: 99, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!