ID: 1042657922_1042657925

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1042657922 1042657925
Species Human (GRCh38) Human (GRCh38)
Location 8:71120678-71120700 8:71120713-71120735
Sequence CCACAAAATAACTTGCTGGGATT GCATTTAAACATATAGATCAAGG
Strand - +
Off-target summary {0: 51, 1: 140, 2: 232, 3: 229, 4: 449} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!