ID: 1042704844_1042704854

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1042704844 1042704854
Species Human (GRCh38) Human (GRCh38)
Location 8:71655206-71655228 8:71655253-71655275
Sequence CCCAAAGTGCTGTGATTACAGGC CTGCTGTTCTTGAGCTGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!