ID: 1042704845_1042704854

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1042704845 1042704854
Species Human (GRCh38) Human (GRCh38)
Location 8:71655207-71655229 8:71655253-71655275
Sequence CCAAAGTGCTGTGATTACAGGCA CTGCTGTTCTTGAGCTGAGAGGG
Strand - +
Off-target summary {0: 859, 1: 98244, 2: 237885, 3: 243190, 4: 214238} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!