ID: 1042976518_1042976522

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1042976518 1042976522
Species Human (GRCh38) Human (GRCh38)
Location 8:74476528-74476550 8:74476553-74476575
Sequence CCTTTGCTTATGAAGCTTAGTCT CAGGATATGAAAGCTGTGGTTGG
Strand - +
Off-target summary {0: 6, 1: 587, 2: 1107, 3: 7056, 4: 3699} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!