ID: 1043102330_1043102334

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1043102330 1043102334
Species Human (GRCh38) Human (GRCh38)
Location 8:76061240-76061262 8:76061258-76061280
Sequence CCACCATGATTATGTTTCCTGAG CTGAGGCCTCTCCAGCCATATGG
Strand - +
Off-target summary No data {0: 14, 1: 308, 2: 2767, 3: 7179, 4: 7664}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!