ID: 1043221435_1043221440

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1043221435 1043221440
Species Human (GRCh38) Human (GRCh38)
Location 8:77670857-77670879 8:77670905-77670927
Sequence CCATTAATGATAGACTGGACAAG GAATACTATGCAGCCATAAAAGG
Strand - +
Off-target summary No data {0: 137, 1: 172, 2: 275, 3: 516, 4: 823}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!