ID: 1043298508_1043298509

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1043298508 1043298509
Species Human (GRCh38) Human (GRCh38)
Location 8:78697440-78697462 8:78697464-78697486
Sequence CCTGGAACTGCATCATCAGGATC TCACGATTACCGCAGCCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 315} {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!