ID: 1043305928_1043305933

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1043305928 1043305933
Species Human (GRCh38) Human (GRCh38)
Location 8:78795077-78795099 8:78795118-78795140
Sequence CCTCAGATTCTTCTGTTGTGAAA CTTTCTCAAGGGCTGTTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 99, 4: 926} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!