ID: 1043428454_1043428460

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1043428454 1043428460
Species Human (GRCh38) Human (GRCh38)
Location 8:80171542-80171564 8:80171563-80171585
Sequence CCGCCGGCGACTCCCGCGAAGTC TCCCCACCCCCAGAGGCGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28} {0: 1, 1: 0, 2: 2, 3: 32, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!