ID: 1044089077_1044089079

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1044089077 1044089079
Species Human (GRCh38) Human (GRCh38)
Location 8:87977096-87977118 8:87977122-87977144
Sequence CCTCTAAGAGAGTGTAATGGGAA CTAACATAGACTTGGCAGTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!