ID: 1044499511_1044499518

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1044499511 1044499518
Species Human (GRCh38) Human (GRCh38)
Location 8:92936418-92936440 8:92936459-92936481
Sequence CCCATTCATTATTACAGGGGGAG GAGGATGAACAGAGGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!