ID: 1044504984_1044504987

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1044504984 1044504987
Species Human (GRCh38) Human (GRCh38)
Location 8:93006744-93006766 8:93006773-93006795
Sequence CCAGACTGCCTCTTTAGGCAGGA CTCCTCCCTCTTCACTGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 103, 3: 202, 4: 518} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!