ID: 1044525057_1044525060

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1044525057 1044525060
Species Human (GRCh38) Human (GRCh38)
Location 8:93242057-93242079 8:93242073-93242095
Sequence CCTGGGTCCACAGCAGCTGTTTG CTGTTTGGCTGCGCTGCACCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!