ID: 1044591317_1044591331

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1044591317 1044591331
Species Human (GRCh38) Human (GRCh38)
Location 8:93916853-93916875 8:93916898-93916920
Sequence CCACTCGTCACTGCGCAGCCAAT CCCGAACGTGCGGGCGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40} {0: 1, 1: 0, 2: 0, 3: 7, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!