ID: 1044678719_1044678724

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1044678719 1044678724
Species Human (GRCh38) Human (GRCh38)
Location 8:94755567-94755589 8:94755592-94755614
Sequence CCCTATTAATTTGCTCAAAGATG GTATAGACAATGGTGGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!