ID: 1044866018_1044866022

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1044866018 1044866022
Species Human (GRCh38) Human (GRCh38)
Location 8:96572030-96572052 8:96572054-96572076
Sequence CCTTCTGTTAAAGGCCATCAGTG TGGCTCAAGCAGTCTCGTGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!