ID: 1045148990_1045148993

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1045148990 1045148993
Species Human (GRCh38) Human (GRCh38)
Location 8:99381547-99381569 8:99381593-99381615
Sequence CCACAATCTCGCCAACATCTGTT CTGTTCTATCTGGTGTGAGATGG
Strand - +
Off-target summary {0: 1, 1: 39, 2: 450, 3: 2316, 4: 8330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!