ID: 1045222664_1045222670

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1045222664 1045222670
Species Human (GRCh38) Human (GRCh38)
Location 8:100213620-100213642 8:100213642-100213664
Sequence CCGGCCAGGCACGTTTGCCTCCG GTCCCCGCCGGGTTTTCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92} {0: 1, 1: 0, 2: 1, 3: 6, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!