ID: 1045222665_1045222677

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1045222665 1045222677
Species Human (GRCh38) Human (GRCh38)
Location 8:100213624-100213646 8:100213655-100213677
Sequence CCAGGCACGTTTGCCTCCGTCCC TTTCCCTTGGTGGCTGTTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105} {0: 1, 1: 0, 2: 8, 3: 17, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!