ID: 1045653425_1045653437

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1045653425 1045653437
Species Human (GRCh38) Human (GRCh38)
Location 8:104364011-104364033 8:104364061-104364083
Sequence CCAGAGGGAGCTCATCCCCTGAT CGTCCACCTGGAACCCACGCTGG
Strand - +
Off-target summary {0: 5, 1: 19, 2: 26, 3: 49, 4: 158} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!