ID: 1045748686_1045748691

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1045748686 1045748691
Species Human (GRCh38) Human (GRCh38)
Location 8:105455853-105455875 8:105455879-105455901
Sequence CCAAATGGAGCTGTTGAGTAGAA TGGTAATATAGCCAGGGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!