ID: 1045826491_1045826506

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1045826491 1045826506
Species Human (GRCh38) Human (GRCh38)
Location 8:106404101-106404123 8:106404152-106404174
Sequence CCTCTACCACTTGAGGTTGTTGG GATGCTGCTACCACTGGGTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!