ID: 1045897970_1045897976

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1045897970 1045897976
Species Human (GRCh38) Human (GRCh38)
Location 8:107240967-107240989 8:107241018-107241040
Sequence CCGACGCCCACGTAGTCTCGCTG CTGCAAGGCGGCAGCGAGGCTGG
Strand - +
Off-target summary No data {0: 1065, 1: 2097, 2: 1670, 3: 692, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!