ID: 1045960688_1045960704

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1045960688 1045960704
Species Human (GRCh38) Human (GRCh38)
Location 8:107964650-107964672 8:107964690-107964712
Sequence CCCCCTGCTCTGTTCAGCCATTT TCTGCTTTGCAGGGGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 355} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!