ID: 1045982398_1045982404

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1045982398 1045982404
Species Human (GRCh38) Human (GRCh38)
Location 8:108206101-108206123 8:108206154-108206176
Sequence CCAGCCAAACCAAACCAATCCTT CCAACCGTGTTAGATGCTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 213} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!