ID: 1046094406_1046094422

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1046094406 1046094422
Species Human (GRCh38) Human (GRCh38)
Location 8:109540056-109540078 8:109540108-109540130
Sequence CCACCTTCCTTTCGCCCTTCCAC CTGGGTACTGTTTCCGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 112, 4: 1222} {0: 1, 1: 0, 2: 0, 3: 15, 4: 552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!