ID: 1046508772_1046508775

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1046508772 1046508775
Species Human (GRCh38) Human (GRCh38)
Location 8:115171938-115171960 8:115171954-115171976
Sequence CCATCCTCACACTACTAATAAAG AATAAAGACATACCCAAGGCTGG
Strand - +
Off-target summary No data {0: 42, 1: 979, 2: 3093, 3: 5607, 4: 7850}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!