ID: 1046508772_1046508776

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1046508772 1046508776
Species Human (GRCh38) Human (GRCh38)
Location 8:115171938-115171960 8:115171955-115171977
Sequence CCATCCTCACACTACTAATAAAG ATAAAGACATACCCAAGGCTGGG
Strand - +
Off-target summary No data {0: 83, 1: 2311, 2: 4383, 3: 7887, 4: 9880}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!