ID: 1046508772_1046508780

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1046508772 1046508780
Species Human (GRCh38) Human (GRCh38)
Location 8:115171938-115171960 8:115171975-115171997
Sequence CCATCCTCACACTACTAATAAAG GGGTAATTTATAAAGGAAAGAGG
Strand - +
Off-target summary No data {0: 3442, 1: 8020, 2: 8919, 3: 8212, 4: 5079}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!