ID: 1046508772_1046508781

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1046508772 1046508781
Species Human (GRCh38) Human (GRCh38)
Location 8:115171938-115171960 8:115171991-115172013
Sequence CCATCCTCACACTACTAATAAAG AAAGAGGTTTAATTGATTCACGG
Strand - +
Off-target summary No data {0: 22, 1: 358, 2: 1860, 3: 2644, 4: 2639}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!