ID: 1046556100_1046556108

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1046556100 1046556108
Species Human (GRCh38) Human (GRCh38)
Location 8:115775360-115775382 8:115775404-115775426
Sequence CCTCAAGGTGGGACCAAAGCTCT CTCCCATGGGATCAGGGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 149} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!