ID: 1046645285_1046645290

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1046645285 1046645290
Species Human (GRCh38) Human (GRCh38)
Location 8:116779146-116779168 8:116779175-116779197
Sequence CCCAACAACGTGAATATATTAGC TGAATTGGTATACTTTAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!