ID: 1046736063_1046736073

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1046736063 1046736073
Species Human (GRCh38) Human (GRCh38)
Location 8:117777800-117777822 8:117777835-117777857
Sequence CCAGTCTGAGAAGTGAGGAGCCC GCCGCCCGGCCTGGGAAGTGAGG
Strand - +
Off-target summary No data {0: 3, 1: 32, 2: 937, 3: 9700, 4: 9590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!