ID: 1046739587_1046739588

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1046739587 1046739588
Species Human (GRCh38) Human (GRCh38)
Location 8:117813978-117814000 8:117814025-117814047
Sequence CCTGGGTGACAGAGTGAGACTCT AAGAAGAAGAAGAAAGAAGAAGG
Strand - +
Off-target summary {0: 9650, 1: 44791, 2: 100947, 3: 156345, 4: 155285} {0: 16, 1: 101, 2: 331, 3: 1363, 4: 7127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!