|
Left Crispr |
Right Crispr |
| Crispr ID |
1046739587 |
1046739588 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:117813978-117814000
|
8:117814025-117814047
|
| Sequence |
CCTGGGTGACAGAGTGAGACTCT |
AAGAAGAAGAAGAAAGAAGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 9650, 1: 44791, 2: 100947, 3: 156345, 4: 155285} |
{0: 16, 1: 101, 2: 331, 3: 1363, 4: 7127} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|